Multiple sclerosis (MS) is an more and more prevalent progressive autoimmune and debilitating power illness that entails the detrimental recognition of central nervous system (CNS) antigens by the immune system. Although vital progress has been made within the final a long time on the biology of MS and the identification of novel therapies to deal with its signs, the etiology of this illness stays unknown. However, latest research have instructed that viral infections might contribute to illness onset. Interestingly, a possible affiliation between herpes simplex virus kind 1 (HSV-1) an infection and MS has been reported, but a direct relationship amongst each has not been conclusively demonstrated.
Experimental autoimmune encephalomyelitis (EAE) recapitulates a number of features of MS in people and is broadly used to review this illness. Here, we evaluated the impact of asymptomatic mind an infection by HSV-1 on the onset and severity of EAE in C57BL/6 mice. We additionally evaluated the impact of an infection with an HSV-1-mutant that’s attenuated in neurovirulence and doesn’t trigger encephalitis. Importantly, we noticed extra extreme EAE in mice beforehand contaminated both, with the wild-type (WT) or the mutant HSV-1, as in comparison with uninfected management mice.
Also, earlier EAE onset was seen after WT virus inoculation. These findings help the notion {that a} earlier publicity to HSV-1 can speed up and improve EAE, which suggests a possible contribution of asymptomatic HSV-1 to the onset and severity of MS. Viral hundreds (VL) monitoring for hepatitis B and C is crucial to judge illness development and remedy response. Automated, random-access speedy programs have gotten commonplace to offer dependable VL to clinicians. The intention of this examine was to judge the analytical performances of the not too long ago launched NeuMoDx™ for HBV-DNA and HCV-RNA quantification.
Strategies for site-specific recombination with excessive effectivity and exact spatiotemporal decision
Site-specific recombinases (SSRs) are invaluable genome engineering instruments which have enormously boosted our understanding of gene features and cell lineage relationships in developmental biology, stem cell biology, regenerative drugs, and a number of illnesses. However, the ever-increasing complexity of biomedical analysis requires the event of novel site-specific genetic recombination applied sciences that may manipulate genomic DNA with excessive effectivity and high quality spatiotemporal management.
Here, we evaluate the newest modern methods of the generally used Cre-loxP recombination system and its combinatorial methods with different SSR programs. We additionally spotlight latest progress with a deal with the brand new era of chemical- and light-inducible genetic programs and focus on the deserves and limitations of every new and established system. Finally, we offer the longer term views of mixing varied recombination programs or enhancing well-established site-specific genetic instruments to realize extra environment friendly and exact spatiotemporal genetic manipulation.
The regular rise in opioid customers and abusers has uncovered a number of detrimental well being penalties of perturbed opioid receptor signaling, thereby creating the necessity to higher perceive the biology of those programs. Among endogenous opioid networks, μ-receptors have obtained particular consideration on account of their unprecedented organic complexity and broad implications in homeostatic features. Here, we evaluate the origin, molecular biology, and physiology of endogenous opioids with a particular deal with μ-opioid receptor networks inside the endocrine system. Moreover, we summarize the present proof supporting an involvement of the latter in regulating distinct endocrine features. Finally, we mix these insights to current an built-in perspective on μ-opioid receptor biology and present an outlook on future research and unresolved questions on this area.
Nitrogen fixation in maize: breeding alternatives
Maize (Zea mays L.) is a extremely versatile crop with enormous demand of nitrogen (N) for its progress and improvement. N is essentially the most important macronutrient for crop manufacturing. Despite being the very best ample component within the ambiance (~ 78%), it’s scarcely obtainable for plant progress. To fulfil the N demand, industrial agriculture is basically depending on artificial fertilizers. Excessive dependence on inorganic fertilizers has created intensive ecological in addition to financial issues worldwide.
Hence, for a sustainable answer to nitrogenous fertilizer use, improvement of organic nitrogen fixation (BNF) in cereals would be the greatest different. BNF is a widely known mechanism in legumes the place diazotrophs convert atmospheric nitrogen (N≡N) to plant-available type, ammonium (NH4+). From many a long time, researchers have dreamt to develop the same symbiotic partnership as in legumes to the cereal crops.
 ASAH2 Polyclonal Antibody |
|
A62106 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: fast delivery possible |
 ASAH2 Rabbit pAb |
|
A12596-100ul |
Abclonal |
100 ul |
EUR 308 |
|
ASAH2 Rabbit pAb |
|
A12596-200ul |
Abclonal |
200 ul |
EUR 459 |
|
ASAH2 Rabbit pAb |
|
A12596-20ul |
Abclonal |
20 ul |
EUR 183 |
|
ASAH2 Rabbit pAb |
|
A12596-50ul |
Abclonal |
50 ul |
EUR 223 |
|
ASAH2 Rabbit pAb |
|
A7985-100ul |
Abclonal |
100 ul |
EUR 308 |
|
ASAH2 Rabbit pAb |
|
A7985-200ul |
Abclonal |
200 ul |
EUR 459 |
|
ASAH2 Rabbit pAb |
|
A7985-20ul |
Abclonal |
20 ul |
EUR 183 |
|
ASAH2 Rabbit pAb |
|
A7985-50ul |
Abclonal |
50 ul |
EUR 223 |
 ASAH2 Antibody |
|
24731-100ul |
SAB |
100ul |
EUR 390 |
 ASAH2 antibody |
|
70R-12124 |
Fitzgerald |
100 ug |
EUR 403 |
|
Description: Rabbit polyclonal ASAH2 antibody |
|
ASAH2 Antibody |
|
36240-100ul |
SAB |
100ul |
EUR 252 |
|
ASAH2 Antibody |
|
1-CSB-PA002170EA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against ASAH2. Recognizes ASAH2 from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:100-1:500, IF:1:50-1:500 |
|
ASAH2 Antibody |
|
1-CSB-PA076840 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
|
Description: A polyclonal antibody against ASAH2. Recognizes ASAH2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100 |
|
ASAH2 Antibody |
|
1-CSB-PA133826 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
|
Description: A polyclonal antibody against ASAH2. Recognizes ASAH2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100 |
 ASAH2 Polyclonal Antibody, HRP Conjugated |
|
A62107 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: reagents widely cited |
 ASAH2 Polyclonal Antibody, FITC Conjugated |
|
A62108 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: Ask the seller for details |
 ASAH2 Polyclonal Antibody, Biotin Conjugated |
|
A62109 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: The best epigenetics products |
 ASAH2 Conjugated Antibody |
|
C36240 |
SAB |
100ul |
EUR 397 |
 ASAH2 siRNA |
|
20-abx900469 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
|
ASAH2 siRNA |
|
20-abx908269 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
|
ASAH2 siRNA |
|
20-abx908270 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 ASAH2 Antibody, HRP conjugated |
|
1-CSB-PA002170EB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against ASAH2. Recognizes ASAH2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
 ASAH2 Antibody, FITC conjugated |
|
1-CSB-PA002170EC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against ASAH2. Recognizes ASAH2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
 ASAH2 Antibody, Biotin conjugated |
|
1-CSB-PA002170ED01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against ASAH2. Recognizes ASAH2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
 ASAH2 Blocking Peptide |
|
33R-10941 |
Fitzgerald |
50 ug |
EUR 191 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ASAH2 antibody, catalog no. 70R-12124 |
|
ASAH2 Blocking Peptide |
|
3828BP-50 |
Biovision |
|
EUR 153 |
 ASAH2 cloning plasmid |
|
CSB-CL865115HU-10ug |
Cusabio |
10ug |
EUR 474 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2181
- Sequence: ATGAGTGCCATCACAGTGGCCCTTCTCAGCCTCTTGTTTATCACCAGTGGGACCATTGAAAACCACAAAGATTTAGGAGGCCATTTTTTTTCAACCACCCAAAGCCCTCCAGCCACCCAGGGCTCCACAGCCGCCCAACGCTCCACAGCCACCCAGCATTCCACAGCCACCCAGA
- Show more
|
|
Description: A cloning plasmid for the ASAH2 gene. |
 Mouse ASAH2 shRNA Plasmid |
|
20-abx974501 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Rat ASAH2 shRNA Plasmid |
|
20-abx987160 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human ASAH2 shRNA Plasmid |
|
20-abx961153 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) ASAH2 Recombinant Protein (Human) |
|
RP036760 |
ABM |
100 ug |
Ask for price |
) ASAH2 Recombinant Protein (Mouse) |
|
RP117410 |
ABM |
100 ug |
Ask for price |
) ASAH2 Recombinant Protein (Rat) |
|
RP191108 |
ABM |
100 ug |
Ask for price |
 Antibody) N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody |
|
20-abx007107 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
|
N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody |
|
abx025039-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
|
N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody |
|
abx025039-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
|
N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody |
|
20-abx214010 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
|
N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody |
|
20-abx214011 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
|
N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody |
|
20-abx177710 |
Abbexa |
|
|
|
|
|
N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody |
|
20-abx173712 |
Abbexa |
|
|
|
|
|
N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody |
|
20-abx303129 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (HRP)) N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody (HRP) |
|
20-abx303130 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (FITC)) N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody (FITC) |
|
20-abx303131 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (Biotin)) N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody (Biotin) |
|
20-abx303132 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 (pORF)) Asah2 ORF Vector (Rat) (pORF) |
|
ORF063704 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) ASAH2 ORF Vector (Human) (pORF) |
|
ORF012254 |
ABM |
1.0 ug DNA |
EUR 354 |
 (pORF)) Asah2 ORF Vector (Mouse) (pORF) |
|
ORF039138 |
ABM |
1.0 ug DNA |
EUR 506 |
 (OKCD01831)) ASAH2 ELISA Kit (Human) (OKCD01831) |
|
OKCD01831 |
Aviva Systems Biology |
96 Wells |
EUR 831 |
|
Description: Description of target: Hydrolyzes the sphingolipid ceramide into sphingosine and free fatty acid at an optimal pH of 6.5-8.5. Acts as a key regulator of sphingolipid signaling metabolites by generating sphingosine at the cell surface. Acts as a repressor of apoptosis both by reducing C16-ceramide, thereby preventing ceramide-induced apoptosis, and generating sphingosine, a precursor of the antiapoptotic factor sphingosine 1-phosphate. Probably involved in the digestion of dietary sphingolipids in intestine by acting as a key enzyme for the catabolism of dietary sphingolipids and regulating the levels of bioactive sphingolipid metabolites in the intestinal tract.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.31 ng/mL |
) Asah2 sgRNA CRISPR Lentivector set (Rat) |
|
K7087001 |
ABM |
3 x 1.0 ug |
EUR 339 |
) ASAH2 sgRNA CRISPR Lentivector set (Human) |
|
K0130501 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Asah2 sgRNA CRISPR Lentivector set (Mouse) |
|
K3499601 |
ABM |
3 x 1.0 ug |
EUR 339 |
 Protein) Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) Protein |
|
20-abx654471 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
 ELISA Kit (CUSTOM)) Mouse ASAH2 (Neutral ceramidase) ELISA Kit (CUSTOM) |
|
ELI-34287m |
Lifescience Market |
96 Tests |
EUR 865 |
 ELISA Kit (CUSTOM)) Human ASAH2 (Neutral ceramidase) ELISA Kit (CUSTOM) |
|
ELI-34330h |
Lifescience Market |
96 Tests |
EUR 824 |
 ELISA Kit (CUSTOM)) Rat ASAH2 (Neutral ceramidase) ELISA Kit (CUSTOM) |
|
ELI-48960r |
Lifescience Market |
96 Tests |
EUR 886 |
 (Target 1)) Asah2 sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K7087002 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Asah2 sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K7087003 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Asah2 sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K7087004 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) ASAH2 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K0130502 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) ASAH2 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K0130503 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) ASAH2 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K0130504 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Asah2 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K3499602 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Asah2 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K3499603 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Asah2 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K3499604 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) ASAH2 Protein Vector (Mouse) (pPB-C-His) |
|
PV156550 |
ABM |
500 ng |
EUR 1065 |
 (pPB-N-His)) ASAH2 Protein Vector (Mouse) (pPB-N-His) |
|
PV156551 |
ABM |
500 ng |
EUR 1065 |
 (pPM-C-HA)) ASAH2 Protein Vector (Mouse) (pPM-C-HA) |
|
PV156552 |
ABM |
500 ng |
EUR 1065 |
 (pPM-C-His)) ASAH2 Protein Vector (Mouse) (pPM-C-His) |
|
PV156553 |
ABM |
500 ng |
EUR 1065 |
 (pPB-C-His)) ASAH2 Protein Vector (Rat) (pPB-C-His) |
|
PV254814 |
ABM |
500 ng |
EUR 1166 |
 (pPB-N-His)) ASAH2 Protein Vector (Rat) (pPB-N-His) |
|
PV254815 |
ABM |
500 ng |
EUR 1166 |
 (pPM-C-HA)) ASAH2 Protein Vector (Rat) (pPM-C-HA) |
|
PV254816 |
ABM |
500 ng |
EUR 1166 |
 (pPM-C-His)) ASAH2 Protein Vector (Rat) (pPM-C-His) |
|
PV254817 |
ABM |
500 ng |
EUR 1166 |
 (pPB-His-MBP)) ASAH2 Protein Vector (Human) (pPB-His-MBP) |
|
PV324138 |
ABM |
500 ng |
EUR 481 |
 (pPB-His-GST)) ASAH2 Protein Vector (Human) (pPB-His-GST) |
|
PV324139 |
ABM |
500 ng |
EUR 481 |
 (pPB-C-His)) ASAH2 Protein Vector (Human) (pPB-C-His) |
|
PV049013 |
ABM |
500 ng |
EUR 481 |
 (pPB-N-His)) ASAH2 Protein Vector (Human) (pPB-N-His) |
|
PV049014 |
ABM |
500 ng |
EUR 481 |
 (pPM-C-HA)) ASAH2 Protein Vector (Human) (pPM-C-HA) |
|
PV049015 |
ABM |
500 ng |
EUR 481 |
 (pPM-C-His)) ASAH2 Protein Vector (Human) (pPM-C-His) |
|
PV049016 |
ABM |
500 ng |
EUR 329 |
 Asah2 3'UTR GFP Stable Cell Line |
|
TU152183 |
ABM |
1.0 ml |
Ask for price |
 Asah2 3'UTR Luciferase Stable Cell Line |
|
TU102183 |
ABM |
1.0 ml |
Ask for price |
|
Asah2 3'UTR Luciferase Stable Cell Line |
|
TU200951 |
ABM |
1.0 ml |
Ask for price |
|
Asah2 3'UTR GFP Stable Cell Line |
|
TU250951 |
ABM |
1.0 ml |
Ask for price |
 ASAH2 3'UTR GFP Stable Cell Line |
|
TU051220 |
ABM |
1.0 ml |
EUR 1521 |
 ASAH2 3'UTR Luciferase Stable Cell Line |
|
TU001220 |
ABM |
1.0 ml |
EUR 1521 |
 ELISA Kit) Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) ELISA Kit |
|
20-abx156834 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
 CLIA Kit) Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) CLIA Kit |
|
20-abx494694 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
|
 (CMV) (pLenti-GIII-CMV)) ASAH2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
|
LV656977 |
ABM |
1.0 ug DNA |
EUR 1355 |
 (UbC) (pLenti-GIII-UbC)) ASAH2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
|
LV656981 |
ABM |
1.0 ug DNA |
EUR 1355 |
 (EF1a) (pLenti-GIII-EF1a)) ASAH2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
|
LV656982 |
ABM |
1.0 ug DNA |
EUR 1355 |
ELISA Kit) Human N-Acylsphingosine Amidohydrolase 2(ASAH2)ELISA Kit |
|
QY-E04735 |
Qayee Biotechnology |
96T |
EUR 361 |
|
Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) ELISA Kit |
|
SEE689Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-
- Show more
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) in serum, plasma, tissue homogenates and other biological fluids. |
|
Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) ELISA Kit |
|
SEE689Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-
- Show more
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) in serum, plasma, tissue homogenates and other biological fluids. |
|
Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) ELISA Kit |
|
SEE689Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-
- Show more
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) in serum, plasma, tissue homogenates and other biological fluids. |
|
Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) ELISA Kit |
|
SEE689Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-
- Show more
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) in serum, plasma, tissue homogenates and other biological fluids. |
|
Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) ELISA Kit |
|
4-SEE689Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as N-Acylsphingosine Amidohydrolase 2 elisa. Alternative names of the recognized antigen: HNAC1
- non-lysosomal ceramidase
- Neutral ceramidase
|
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species. |
 GAPDH Rabbit Polyclonal Antibody |
|
37985-100ul |
SAB |
100ul |
EUR 252 |
|
GAPDH Rabbit Polyclonal Antibody |
|
37985-50ul |
SAB |
50ul |
EUR 187 |
 EFHD1 Rabbit Polyclonal Antibody |
|
38001-100ul |
SAB |
100ul |
EUR 252 |
|
EFHD1 Rabbit Polyclonal Antibody |
|
38001-50ul |
SAB |
50ul |
EUR 187 |
 Alliinase Rabbit Polyclonal Antibody |
|
38042-100ul |
SAB |
100ul |
EUR 252 |
|
Alliinase Rabbit Polyclonal Antibody |
|
38042-50ul |
SAB |
50ul |
EUR 187 |
 ECFP Rabbit Polyclonal Antibody |
|
38077-100ul |
SAB |
100ul |
EUR 252 |
|
ECFP Rabbit Polyclonal Antibody |
|
38077-50ul |
SAB |
50ul |
EUR 187 |
 EYFP Rabbit Polyclonal Antibody |
|
38078-100ul |
SAB |
100ul |
EUR 252 |
|
EYFP Rabbit Polyclonal Antibody |
|
38078-50ul |
SAB |
50ul |
EUR 187 |
 mOrange Rabbit Polyclonal Antibody |
|
38079-100ul |
SAB |
100ul |
EUR 252 |
|
mOrange Rabbit Polyclonal Antibody |
|
38079-50ul |
SAB |
50ul |
EUR 187 |
 mStrawberry Rabbit Polyclonal Antibody |
|
38083-100ul |
SAB |
100ul |
EUR 252 |
|
mStrawberry Rabbit Polyclonal Antibody |
|
38083-50ul |
SAB |
50ul |
EUR 187 |
 AmCyan Rabbit Polyclonal Antibody |
|
38086-100ul |
SAB |
100ul |
EUR 252 |
|
AmCyan Rabbit Polyclonal Antibody |
|
38086-50ul |
SAB |
50ul |
EUR 187 |
 EBFP Rabbit Polyclonal Antibody |
|
38087-100ul |
SAB |
100ul |
EUR 252 |
|
EBFP Rabbit Polyclonal Antibody |
|
38087-50ul |
SAB |
50ul |
EUR 187 |
 Vimentin Rabbit Polyclonal Antibody |
|
38104-100ul |
SAB |
100ul |
EUR 252 |
|
Vimentin Rabbit Polyclonal Antibody |
|
38104-50ul |
SAB |
50ul |
EUR 187 |
 LDHD Rabbit Polyclonal Antibody |
|
38105-100ul |
SAB |
100ul |
EUR 252 |
|
LDHD Rabbit Polyclonal Antibody |
|
38105-50ul |
SAB |
50ul |
EUR 187 |
|
GAPDH Rabbit Polyclonal Antibody |
|
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
|
GAPDH Rabbit Polyclonal Antibody |
|
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
|
GAPDH Rabbit Polyclonal Antibody |
|
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
 Rabbit Hemoglobin Polyclonal Antibody |
|
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: The best epigenetics products |
 Met Rabbit Polyclonal Antibody |
|
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
|
Met Rabbit Polyclonal Antibody |
|
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
|
Met Rabbit Polyclonal Antibody |
|
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
 VEGF Rabbit Polyclonal Antibody |
|
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
|
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
|
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
Numerous endophytic diazotrophs have been discovered related to maize. Elucidation of the genetic and molecular features of their interplay will open up new avenues to introgress BNF in maize breeding. With the superior understanding of N-fixation course of, researchers are at a juncture of breeding and engineering this symbiotic relationships in cereals. Different breeding, genetic engineering, omics, gene enhancing, and artificial biology approaches will probably be mentioned on this evaluate to make BNF a actuality in cereals. It will assist to offer a highway map to develop/enhance the BNF in maize to an advance step for the sustainable manufacturing system to realize the meals and dietary safety.
Anti-ASAH2 antibody